KitchenAid® 40 Oz Glass Jar for Blender (Fits model KSB354) gasket, collar and lid not included Replacement part for KitchenAid® BlenderSign In to ManualsOnline Sign Up for ManualsOnline Can blend hot foods and crush ice Dedicated function buttons with tailored programmes Noisy on top speed No recipe book supplied The KitchenAid Diamond Blender is for those who like their sauces and soups smooth and their smoothies even silkier. A more mature version of the loveably retro Artisan Blender, the Diamond offers greater capacity and a host of handy functions that enable it to tackle almost any food that’s popped into its pitcher. Hot food and ice are its speciality, but it also promises to speed through lumpy gravy, frozen food, fruits, vegetables, meat, biscuits and bread.Called the Diamond for its durability as well as its faceted jug, this blender has inherited some design features from the Artisan blender, but most are new additions.Gone is the glass jug, replaced by a lighter plastic pitcher with four blades.

Its capacity is far more generous at a large 1.75 litres, with clearly visible measurements on the front and back (in cups/oz and ml/l), a tight-fitting push-on lid and detachable measuring cup.The buttons on the front panel are sleeker and more angular, and while the functions are represented by symbols, they’re easy to understand without checking the manual. kitchenaid blender parts model ksb50b4Five buttons across the top control the main functions – Hot Food, Chop, Mix, Puree and Liquify – while Crush Ice and Pulse sit to one side of the power button.vitamix drink machine vm0100The base itself, as with most KitchenAid models, is made from die-cast metal in one of four colours: Empire Red, Onyx Black, Almond Cream or Contour Silver. oster hand blender 2614 parts

A handy cable store underneath takes care of any extra flex, which at 114.3cm, helps to give several options for where the blender’s used.Footprint-wise, the machine is relatively compact compared to most, but it’s tall to accommodate the capacity of the jug, meaning it may have to live on a worktop instead of in a cupboard, unless it’s disassembled. kitchenaid mixer model kv25mcxIt weighs an average 4.5kg, so moving it around isn’t too arduous.oster hand mixer model 2494While there isn’t a recipe book included, there are plenty of tips for getting the best results from different foods – such as making baby food or pancake batter – in the instructions.vitamix tnc 5200 malaysiaSEE ALSO: Best Coffee Machines Round-upPutting the machine together is an intuitive process – the jug swivels securely into the base, its lid pushes on top until it’s clearly in place and the measuring cup twists in. bamix gordon ramsay stavmikser

The lid features a loop to remove it and there are no interlocking grooves, which makes taking it off far easier. It also fits over the spout, so there are no splashes.We started by using the Chop function on carrots. While dropping them in intermittently worked at first, the Diamond chops finely and the prepared carrots began to clump, holding onto larger chunks that had spun away from the blades. Starting with a larger amount and scraping between uses gave a better result, although it wasn’t as consistent as a food processor.SEE ALSO: Best Toasters Round-upThe Hot Food function performed far better. It runs as a programme, starting slowly at 2000rpm and rising to a breathtaking 11,500rpm. The top speed is incredibly loud for the short time it’s running, but the consistency of the steaming carrot and lentil soup we’d put in was sublime – thick, viscous and impressively restaurant-standard. Scraping the jug out while avoiding the blades is a little awkward, but the straight sides make it easier.

Next, we tried the Crush Ice function. A pulsing programme, it again has a slow start that transforms cubes into a fine snow without turning it to water, making it ideal for flavoured slush and cocktails. Finally, we used the Liquify function to make frozen yoghurt from pre-frozen plain yoghurt and fruit. While this took a little longer than crushing ice, the result was smooth and still partially frozen, needing only a little extra time to refreeze solid.Cleaning afterwards was simple – it’s both suitable for washing by hand and dishwashing, plus the durable finish of the base means it only needs a quick wipe over to remove any residue.There’s no denying that there are lots of blenders on the market, but there are far few that are as well thought out and robust as this one. Rather than a one-speed-fits-all approach, the Diamond’s tailored programmes take the guesswork out of daily food preparation – essential if you’re keen to achieve effortlessly smooth results every time.

A host of design features make it easy to use, plus there are some elements, such as its leak-preventing one-piece pitcher and its snugly fitting lid, that ensure it’ll still be blitzing through food in years to come.Offering reliability, power and functionality without a high-end price tag, the Diamond Blender could be a cook’s best friend.Next, read more Home Appliance ReviewsMikhaylova et al. 10.1073/pnas.0605087103. Protein Extracts from Dissected Tissues and EMSA. Tissues were manually dissected in PBS and proteins extracted in ice-cold extraction buffer (20 mM Tris·HCl, 1.5 M KCl, 2 mM EDTA, 0.4% Triton X-100, 0.04% b-mercaptoethanol, 10% glycerol, 1 mM PMSF, and 1 mg/ml each pepstatin, leupeptin, and trypsin inhibitor, pH 7.5). Extracts were cleared from the debris by centrifugation (16,000 × g for 10 min.) at 4°C, and dialyzed against the binding buffer (20 mM Hepes, 50 mM KCl, 5 mM MgCl2, 1 mM CaCl2, 0.05% Triton X-100, 0.04% b-mercaptoethanol, and 10% glycerol, pH 7.9) by using the 10-kDa MWCO cassettes (Pierce).

Protein concentrations were determined with the Bradford assay. Double-stranded oligonucleotide AGCTTTGATCGTAGTGTGCCTTTGGGGGAAATTCTG (the TSE probe) or PCR-amplified core promoter fragments labeled to specific activity of 3 ´ 106 dpm/pmol with polynucleotide kinase (Invitrogen) and [g-32P]ATP (PerkinElmer) were used as the probes for EMSA. The 20-ml EMSA reactions contained 5 mg of crude protein extract (or, alternatively, 1 ml of the protein fractions during purification of the TSE-binding factor or 5 ng of the purified recombinant Modulo), 2 mg of acetylated BSA, 1.5 ´ 103 dpm of labeled probe, and 20 pmol of the nonspecific double-stranded oligonucleotide competitor #1 GGATGCGTATCCGCCGGCGTCGTTTCGCTTATAC in the binding buffer. After 25-min incubation at room temperature, reaction products were separated by electrophoresis in 5% polyacrylamide gels containing 0.5× TBE and 10% glycerol. Specific competitor (the unlabeled TSE probe) and the nonspecific competitor #2 (the double-stranded oligonucleotide TTCGATCAAATCTAACTTTATTCCATATAGTTGCTTATAC) were used in 100-fold molar excess

to the labeled probe.The TSE sequence was flanked with the TC overhang at the 5' end and with the AG overhang at the 3' end to drive the "head-to-tail"Oligonucleotides TSE-U and TSE-L were phosphorylated at the 5' end. One of the oligonucleotides (TSE-Lbio) was also synthesized with the 3' biotin-TEG modification. A mixture of 10 parts of TSE-U, 9 parts of TSE-L, and 1 part of TSE-Lbio was annealed, and oligonucleotides concatenated with DNA ligase (New England Biolabs) to yield an average of 10 tandem repeats of the TSE sequence. Two hundred picomoles of biotinylated ligation products were loaded onto 2 mg of streptavidin-coated magnetic beads (Dynabeads M-280; Dynal) according to the manufacturer’s recommendations. Purification of the TSE-Binding Activity. Three hundred grams of adult Drosophila melanogaster frozen at –80°C were homogenized in 1 liter of ice-cold extraction buffer by blending in the KitchenAid KSB5MC4 blender for 4 min at 4°C at the highest speed.

The lysate was cleared by centrifugation at 15,000 × g for 20 min at 4°C. Proteins precipitated by addition of solid (NH4)2SO4 to 1.2 M were discarded and proteins precipitated in 2.4 M (NH4)2SO4 collected by centrifugation as above. The pellet was dissolved in 300 ml of buffer D (10 mM potassium phosphate, 50 mM KCl, 5 mM MgCl2, 0.05% Triton X-100, 0.04% b-mercaptoethanol, and 10% glycerol, pH 7.0). The solution was desalted on the Sephadex G-50 column (Amersham Pharmacia) on the BioLogic LP system (Bio-Rad) and then loaded onto the 20-ml heparin–Sepharose column (Amersham Pharmacia). further steps were performed on the BioLogic DuoFlow system (Bio-Rad). The column was developed with 300 ml of the 0–1 M linear gradient of KCl in buffer D and the 2-ml fractions analyzed by EMSA for the TSE-binding activity, and the positive fractions were pooled, desalted on the 70-ml Sephadex G-50 column, and loaded onto the Uno Q-1 column (Bio-Rad). The proteins were eluted

with 15 ml of the 0–1 M linear gradient of KCl in the buffer D. The 1-ml fractions positive for the TSE-binding activity by EMSA were pooled, desalted on the 30-ml Sephadex G-50 column, loaded onto the Uno S polishing column (Bio-Rad), and eluted with 3 ml of the 0–1 M linear gradient of KCl in buffer D. The 0.15-ml fractions positive for the TSE-binding activity were pooled, loaded on the Superdex-200 HR column (Amersham Pharmacia), and eluted in buffer D. The 1-ml fractions that contained the TSE-binding activity were pooled, supplemented with CaCl2 to 1 mM and with the nonspecific oligonucleotide competitor #1 to 20 mg/ml, and incubated with 0.2 mg/ml DNA affinity beads for 30 min at room temperature. The beads were washed three times with buffer D containing 1 mM CaCl2 and 20 mg/ml the nonspecific oligonucleotide competitor, and step-eluted with increasing concentrations of KCl (ranging from 0.1 M to 3 M) in buffer D. Proteins were fractionated by SDS/PAGE in the 4–15% gradient gel and stained by using colloidal Coomassie

The protein bands were excised and sent for identification by nano-LC/MS/MS to Midwest Bio Services (Overland Western and Southwestern Blot Analyses. Proteins were separated by SDS/PAGE in 4–15% gels (Bio-Rad) and transferred onto the Nybond-ECL membrane. blot analysis, membranes were blocked overnight at 4°C in 5% nonfat dry milk (NFDM) in PBS containing 0.05% Tween 20 (PBST) and then incubated with 0.5 mg/ml primary antibody in blocking solution overnight at 4°C and washed extensively in PBST. The primary polyclonal antibody against Modulo was raised in chicken against the peptide SVSQPRNKEENNERT and affinity-purified at the Aves Labs. The primary polyclonal affinity-purified antibody raised in guinea pig against Sa was a generous gift from Dr. X. Chen (Stanford University, Stanford, CA). (goat anti-chicken, Aves Labs, or goat anti-guinea pig, Abcam) were used at a concentration of 20 ng/ml in PBST containingAfter 1 h incubation with the secondary antibody at room temperature, membranes were washed in PBST and developed

by using the SuperSignal West Femta substrate (Pierce). For the Southwestern blot analysis, membranes were soaked for 1 h at room temperature in buffer D containing 6 M guanidinium chloride, followed by sequential incubation in buffer D containing 3, 1.5, 0.75, 0.38, 0.19, and 0.1 M guanidinium chloride (15 min per step at room temperature) and a final 30-min incubation in buffer D. Membranes were blocked overnight at 4°C in buffer D containing 0.1 mg/ml acetylated BSA and 20 mg/ml nonspecific competitor #1 and incubated for 2 h at room temperature in solution containing 0.1 mg/ml acetylated BSA, 20 mg/ml nonspecific competitor #1, and 2 ´ 106 dpm/ml 32P-labeled double-stranded TSE probe in the binding buffer. Membranes were washed extensively in buffer D at room temperature and exposed to the BioMax MS film (Kodak).Three hundred testes dissected from the 1-day-old wild-type males were gently homogenized in PBS and treated with 1 mM dithiobis[succinimidyl propionate] (Pierce) for 30 min at room temperature in the presence of protease inhibitors (Complete;

was quenched with 50 mM Tris·HCl (pH 8.0) for 15 min and proteins extracted with 1% SDS. The lysate was diluted 10-fold with 0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 167 mM NaCl, and 16.7 mM Tris·HCl (pH 8.1), cleared from the debris by centrifugation (16,000 × g for 15 min), and preincubated overnight with agarose beads conjugated with the goat anti-chicken antibody (PrecipHen; Labs) or with the protein G (Upstate Bitecnology, Lake Placid, NY). After removal of the beads, the lysates were divided intoone was saved as the input sample, another reserved for mock-IP, and the third sample incubated for 4–6 h with 3 mg of primary antibody against Modulo or Sa. The agarose beads covered with either goat anti-chicken antibody or protein G were added to the mock-IP sample and to the sample treated with the primary antibody and incubated overnight. washed extensively with the RIPA buffer and the bound proteins eluted by boiling for 2 min in the Laemmli loading buffer.

The DSP cross-link was cleaved by boiling with 10 mM b-mercaptoethanol for 15 min, and the proteins were analyzed by Western blotting.Testes were dissected from the 1-day-old males in PBS, fixed in 4% formaldehyde in PBS on ice for 25 min, washed with PBST, and sandwiched between the two charged Superfrost/Plus microscope slides (Fisher). The sandwich was frozen in liquid nitrogen and the slides separated by using a razor blade. Slides were incubated in 4% formaldehyde and 0.1% Triton X-100 in PBS on ice for 25 min, washed with PBST, and blocked in 3% BSA in PBST overnight at 4°C. Further treatments were at room temperature. Primary antibody against Modulo was diluted to 1 mg/ml with the blocking solution and incubated with the slides for 3 h. The slides were washed extensively with PBST and incubated with the secondary antibody (goat anti-chicken Alexa Fluor 594-conjugated; Molecular Probes) diluted to 4 mg/ml in the blocking solution. Slides were washed in PBST, briefly air-dried, and mounted in the DAPI-containing VectaShield